Product Details

SNP ID: rs182599128
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:37089814 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CACTAGGCTGTGAAAACAAAGGGTT[G/T]GCCTTGCTCCAAAAGATGGGCTATA
Phenotype: MIM: 176871
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: EIF2AK2 PubMed Links

Gene Details

Gene: EIF2AK2
Gene Name: eukaryotic translation initiation factor 2 alpha kinase 2

There are no transcripts associated with this gene.

Gene: GPATCH11
Gene Name: G-patch domain containing 11

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001278505.1	367	Intron			NP_001265434.1
NM_001322249.1	367	Missense Mutation	TTG,TTT	L100F	NP_001309178.1
NM_174931.3	367	Missense Mutation	TTG,TTT	L100F	NP_777591.3
XM_017003748.1	367	Intron			XP_016859237.1

Gene: HEATR5B
Gene Name: HEAT repeat containing 5B

There are no transcripts associated with this gene.

View Full Product Details