Product Details

SNP ID: rs182390255
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:31953791 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CAGCATGGGCTGTTTTCGGGCTATG[C/T]TGACTTTGAGCTGTACAGACTCCAC
Phenotype: MIM: 613927 MIM: 138470 MIM: 154040 MIM: 600478
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: C2 PubMed Links

Gene Details

Gene: C2
Gene Name: complement component 2

There are no transcripts associated with this gene.

Gene: CFB
Gene Name: complement factor B

There are no transcripts associated with this gene.

Gene: MIR1236
Gene Name: microRNA 1236

There are no transcripts associated with this gene.

Gene: NELFE
Gene Name: negative elongation factor complex member E

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_002904.5	1187	Missense Mutation	AAC,AGC	N328S	NP_002895.3
XM_006715205.3	1187	Missense Mutation	AAC,AGC	N323S	XP_006715268.1
XM_011514913.2	1187	Missense Mutation	AAC,AGC	N273S	XP_011513215.1
XM_017011299.1	1187	Missense Mutation	AAC,AGC	N268S	XP_016866788.1

Gene: SKIV2L
Gene Name: Ski2 like RNA helicase

There are no transcripts associated with this gene.

View Full Product Details