Product Details

SNP ID: rs183029853
Assay Type: Functionally tested
NCBI dbSNP Submissions: 4
Location: Chr.1:151838958 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ACGGGCCGCAGGCTCCGCGGCCCCC[A/G]CCTTATAGCCAGCTTTTTCCAAGAG
Phenotype: MIM: 602943 MIM: 615653
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: C2CD4D PubMed Links

Gene Details

Gene: C2CD4D
Gene Name: C2 calcium dependent domain containing 4D

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001136003.1	1081	Missense Mutation	GCG,GTG	A11V	NP_001129475.1
XM_011509055.2	1081	Missense Mutation	GCG,GTG	A11V	XP_011507357.1
XM_016999989.1	1081	Missense Mutation	GCG,GTG	A11V	XP_016855478.1

Gene: LOC100132111
Gene Name: uncharacterized LOC100132111

There are no transcripts associated with this gene.

Gene: RORC
Gene Name: RAR related orphan receptor C

There are no transcripts associated with this gene.

Gene: THEM5
Gene Name: thioesterase superfamily member 5

There are no transcripts associated with this gene.

View Full Product Details