Product Details

SNP ID: rs182909729
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:81902502 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGGCCGGCGCCTCCCCGGAGCTGCA[A/G]CTGCACCCCAGGCTGCGGAGCCTCG
Phenotype: MIM: 614534 MIM: 607996 MIM: 602679 MIM: 606212
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ANAPC11 PubMed Links

Gene Details

Gene: ANAPC11
Gene Name: anaphase promoting complex subunit 11

There are no transcripts associated with this gene.

Gene: NPB
Gene Name: neuropeptide B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_148896.4	3536	Silent Mutation	CAA,CAG	Q75Q	NP_683694.1

Gene: PCYT2
Gene Name: phosphate cytidylyltransferase 2, ethanolamine

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001184917.2	3536	Intron			NP_001171846.1
NM_001256433.2	3536	Intron			NP_001243362.1
NM_001256434.2	3536	Intron			NP_001243363.1
NM_001256435.2	3536	Intron			NP_001243364.1
NM_001282203.1	3536	Intron			NP_001269132.1
NM_001282204.1	3536	Intron			NP_001269133.1
NM_002861.4	3536	Intron			NP_002852.1
XM_005256386.3	3536	UTR 3			XP_005256443.1
XM_005256387.3	3536	UTR 3			XP_005256444.1
XM_006722287.3	3536	UTR 3			XP_006722350.1
XM_017024910.1	3536	UTR 3			XP_016880399.1
XM_017024911.1	3536	UTR 3			XP_016880400.1
XM_017024912.1	3536	UTR 3			XP_016880401.1

Gene: SIRT7
Gene Name: sirtuin 7

There are no transcripts associated with this gene.

View Full Product Details