Product Details

SNP ID: rs184838795
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:9840250 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTGGCTACCACACGAAAGTGACTGA[C/G]AGTCTTCTTGACACCTTCCAGGATG
Phenotype
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: ARPC4-TTLL3 PubMed Links

Gene Details

Gene: ARPC4-TTLL3
Gene Name: ARPC4-TTLL3 readthrough

There are no transcripts associated with this gene.

Gene: LOC107986062
Gene Name: endogenous retrovirus group K member 9 Pol protein-like

There are no transcripts associated with this gene.

Gene: RPUSD3
Gene Name: RNA pseudouridylate synthase domain containing 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001142547.1	660	Missense Mutation	CTC,GTC	L205V	NP_001136019.1
NM_173659.3	660	Missense Mutation	CTC,GTC	L220V	NP_775930.2
XM_011533627.2	660	Missense Mutation	CTC,GTC	L220V	XP_011531929.1

Gene: TTLL3
Gene Name: tubulin tyrosine ligase like 3

There are no transcripts associated with this gene.

View Full Product Details