Product Details
- SNP ID
-
rs186347135
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.4:164957158 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- CAGGGCTTCGGGTCTCCCTAACAGA[C/G]CTTATACGCTGACCGGCGGCCGCCA
- Phenotype
-
- Polymorphism
- C/G, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
FAM218A
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs114687448] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- FAM218A
- Gene Name
- family with sequence similarity 218 member A
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_153027.1 |
211 |
Missense Mutation |
|
|
NP_694572.1 |
- Gene
- TRIM61
- Gene Name
- tripartite motif containing 61
View Full Product Details