Product Details

SNP ID: rs187043199
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:9947241 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGCCGCTAGCCAGCAGCCCCAGCGC[A/G]CCCGCCACAGCCAACAGCCGAGGGC
Phenotype: MIM: 607170
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CRELD1 PubMed Links

Gene Details

Gene: CRELD1
Gene Name: cysteine rich with EGF like domains 1

There are no transcripts associated with this gene.

Gene: PRRT3
Gene Name: proline rich transmembrane protein 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001318871.1	3948	Intron			NP_001305800.1
NM_207351.4	3948	Silent Mutation			NP_997234.3
XM_011533628.2	3948	Silent Mutation			XP_011531930.1
XM_011533629.2	3948	Silent Mutation			XP_011531931.1
XM_017006256.1	3948	Silent Mutation			XP_016861745.1

Gene: PRRT3-AS1
Gene Name: PRRT3 antisense RNA 1

There are no transcripts associated with this gene.

View Full Product Details