Product Details

SNP ID: rs187673472
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:6975778 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCCCTCACCTGTGCAAAACTTACCA[C/T]AGCCTTTGAGGAAGTATGGGGGGTC
Phenotype: MIM: 611531 MIM: 611950 MIM: 610704 MIM: 615642
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: EMG1 PubMed Links

Gene Details

Gene: EMG1
Gene Name: EMG1, N1-specific pseudouridine methyltransferase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001320049.1	697	Missense Mutation	ACA,ATA	T185I	NP_001306978.1
NM_006331.7	697	Missense Mutation	ACA,ATA	T235I	NP_006322.4

Gene: LPCAT3
Gene Name: lysophosphatidylcholine acyltransferase 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_005768.5	697	Intron			NP_005759.4

Gene: PHB2
Gene Name: prohibitin 2

There are no transcripts associated with this gene.

Gene: SCARNA12
Gene Name: small Cajal body-specific RNA 12

There are no transcripts associated with this gene.

View Full Product Details