Product Details

SNP ID: rs187806620
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.7:100124817 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGAGCAGGAGGAGGAGGAGGAAGAG[A/G]AGGAAGAGGAAGGGGGAGACAAGAT
Phenotype: MIM: 610047 MIM: 602955
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CNPY4 PubMed Links

Gene Details

Gene: CNPY4
Gene Name: canopy FGF signaling regulator 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_152755.1	779	Missense Mutation	AAG,GAG	K226E	NP_689968.1

Gene: LAMTOR4
Gene Name: late endosomal/lysosomal adaptor, MAPK and MTOR activator 4

There are no transcripts associated with this gene.

Gene: MBLAC1
Gene Name: metallo-beta-lactamase domain containing 1

There are no transcripts associated with this gene.

Gene: TAF6
Gene Name: TATA-box binding protein associated factor 6

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001190415.1	779	Intron			NP_001177344.1
NM_005641.3	779	Intron			NP_005632.1
NM_139315.2	779	Intron			NP_647476.1

View Full Product Details