Product Details

SNP ID: rs188726115
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.19:5893045 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCCTTTCTCAGGGAGCCCGAGGCCC[A/G]GGCACCCAGCTCCGGAAGTGGACGT
Phenotype: MIM: 612638
Polymorphism: A/G, Transition Substitution
Allele Nomenclature
Literature Links: NDUFA11 PubMed Links
Additional Information: For this assay, SNP(s) [rs12980262] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001193375.1	864	Missense Mutation	CGG,TGG	R187W	NP_001180304.1
NM_175614.4	864	Intron			NP_783313.1