Product Details

SNP ID: rs189043504
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:12675846 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCTGGGACCGCAGCCGCTCAGTCCT[C/T]GTTCTTCTCATGCATGAAGGCATCC
Phenotype: MIM: 600944 MIM: 609458 MIM: 616850
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: DHPS PubMed Links

Gene Details

Gene: DHPS
Gene Name: deoxyhypusine synthase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001206974.1	1234	Missense Mutation	AAG,GAG	K326E	NP_001193903.1
NM_001930.3	1234	Missense Mutation	AAG,GAG	K368E	NP_001921.1
NM_013406.2	1234	Missense Mutation	AAG,GAG	K321E	NP_037538.1
XM_011527770.1	1234	Missense Mutation	AAG,GAG	K368E	XP_011526072.1
XM_011527771.2	1234	Missense Mutation	AAG,GAG	K185E	XP_011526073.1

Gene: MAN2B1
Gene Name: mannosidase alpha class 2B member 1

There are no transcripts associated with this gene.

Gene: WDR83
Gene Name: WD repeat domain 83

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001099737.2	1234	Intron			NP_001093207.1
NM_032332.3	1234	Intron			NP_115708.1

Gene: WDR83OS
Gene Name: WD repeat domain 83 opposite strand

There are no transcripts associated with this gene.

View Full Product Details