Product Details

SNP ID: rs189970558
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:109441553 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGGCATCCTCACCGCTTCCCTCAGG[C/T]GTGGAGTGAGCAGGACTTCCAGTAC
Phenotype: MIM: 607129 MIM: 603498
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: MICAL1 PubMed Links

Gene Details

Gene: MICAL1
Gene Name: microtubule associated monooxygenase, calponin and LIM domain containing 1

There are no transcripts associated with this gene.

Gene: PPIL6
Gene Name: peptidylprolyl isomerase like 6

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001111298.2	543	Intron			NP_001104768.2
NM_001286360.1	543	Intron			NP_001273289.1
NM_001286361.1	543	Intron			NP_001273290.1
NM_173672.4	543	Intron			NP_775943.1
XM_011535765.2	543	Intron			XP_011534067.1
XM_011535766.2	543	Intron			XP_011534068.1
XM_011535767.2	543	Intron			XP_011534069.1
XM_011535769.2	543	Intron			XP_011534071.1
XM_017010774.1	543	Intron			XP_016866263.1

Gene: SMPD2
Gene Name: sphingomyelin phosphodiesterase 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_003080.2	543	Missense Mutation	GCG,GTG	A50V	NP_003071.2
XM_005267109.1	543	UTR 5			XP_005267166.1
XM_011536079.1	543	UTR 5			XP_011534381.1

View Full Product Details