Product Details

SNP ID: rs7322559
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.13:39343656 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTGTGTGTGTGTGTGTGTGTTGTAC[A/G]TTAACAATACTCTGTGGAATAGAAA
Phenotype: MIM: 606710
Polymorphism: A/G, Transition Substitution
Allele Nomenclature
Literature Links: LHFP PubMed Links
Additional Information: For this assay, SNP(s) [rs71770047] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_005780.2	1394	UTR 3			NP_005771.1
XM_011534861.1	1394	UTR 3			XP_011533163.1