Product Details

SNP ID: rs201997221
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:64307437 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCTGCCTGGTCTGTGGGGACGTGGC[C/T]TCCGGCTACCACTATGGTGTGGCAT
Phenotype: MIM: 601998 MIM: 605720
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ESRRA PubMed Links

Gene Details

Gene: ESRRA
Gene Name: estrogen related receptor alpha

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001282450.1	479	Intron			NP_001269379.1
NM_001282451.1	479	Silent Mutation	GCC,GCT	A86A	NP_001269380.1
NM_004451.4	479	Silent Mutation	GCC,GCT	A86A	NP_004442.3
XM_017017313.1	479	Silent Mutation	GCC,GCT	A96A	XP_016872802.1

Gene: KCNK4
Gene Name: potassium two pore domain channel subfamily K member 4

There are no transcripts associated with this gene.

Gene: KCNK4-TEX40
Gene Name: KCNK4-TEX40 readthrough

There are no transcripts associated with this gene.

Gene: TEX40
Gene Name: testis expressed 40

There are no transcripts associated with this gene.

Gene: TRMT112
Gene Name: tRNA methyltransferase 11-2 homolog (S. cerevisiae)

There are no transcripts associated with this gene.

View Full Product Details