Product Details

SNP ID
rs201028627
Assay Type
Functionally tested
NCBI dbSNP Submissions
NA
Location
Chr.12:50401023 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
AGCAGAGGACGACATGTTGCTTTTC[A/G]TGGAGGTGAGTGCATTATGCTAGTC
Phenotype
Polymorphism
A/G, Transition substitution
Allele Nomenclature
Literature Links
FAM186A PubMed Links

Gene Details

Gene
FAM186A
Gene Name
family with sequence similarity 186 member A
There are no transcripts associated with this gene.

Gene
LARP4
Gene Name
La ribonucleoprotein domain family member 4
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001170803.1 163 Missense Mutation ATG,GTG M5V NP_001164274.1
NM_001170804.1 163 Missense Mutation ATG,GTG M5V NP_001164275.1
NM_001170808.1 163 Missense Mutation ATG,GTG M5V NP_001164279.1
NM_052879.4 163 Missense Mutation ATG,GTG M5V NP_443111.4
NM_199188.2 163 Missense Mutation ATG,GTG M5V NP_954658.2
NM_199190.2 163 Missense Mutation ATG,GTG M5V NP_954660.1
XM_005268613.2 163 UTR 5 XP_005268670.1
XM_011537828.2 163 UTR 5 XP_011536130.1
XM_011537829.2 163 UTR 5 XP_011536131.1
XM_011537830.2 163 Intron XP_011536132.1
XM_011537831.2 163 Intron XP_011536133.1
XM_011537833.2 163 UTR 5 XP_011536135.1
XM_011537834.2 163 UTR 5 XP_011536136.1
XM_011537835.2 163 UTR 5 XP_011536137.1
XM_011537836.2 163 UTR 5 XP_011536138.1
XM_011537838.2 163 Intron XP_011536140.1
XM_011537839.2 163 Intron XP_011536141.1
XM_011537840.2 163 UTR 5 XP_011536142.1
XM_011537841.2 163 Intron XP_011536143.1
XM_011537843.2 163 UTR 5 XP_011536145.1
XM_011537844.2 163 UTR 5 XP_011536146.1
XM_017018750.1 163 Missense Mutation ATG,GTG M5V XP_016874239.1
XM_017018751.1 163 Intron XP_016874240.1
XM_017018752.1 163 Intron XP_016874241.1
XM_017018753.1 163 Intron XP_016874242.1
XM_017018754.1 163 UTR 5 XP_016874243.1
XM_017018755.1 163 Missense Mutation ATG,GTG M5V XP_016874244.1
XM_017018756.1 163 UTR 5 XP_016874245.1
XM_017018757.1 163 UTR 5 XP_016874246.1
XM_017018758.1 163 UTR 5 XP_016874247.1
XM_017018759.1 163 Intron XP_016874248.1
XM_017018760.1 163 Missense Mutation ATG,GTG M5V XP_016874249.1
XM_017018761.1 163 Missense Mutation ATG,GTG M5V XP_016874250.1
XM_017018762.1 163 Missense Mutation ATG,GTG M5V XP_016874251.1

View Full Product Details