Product Details

SNP ID: rs200554473
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.13:113158673 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCTCCGGGTGGGAATGGCAGGCTGC[A/G]TCCCACTGCTCCAGGGCCTGGTCCT
Phenotype: MIM: 613872 MIM: 613713 MIM: 176895
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: F10 PubMed Links

Gene Details

Gene: F10
Gene Name: coagulation factor X

There are no transcripts associated with this gene.

Gene: LOC102724474
Gene Name: WAS/WASL-interacting protein family member 2-like

There are no transcripts associated with this gene.

Gene: PCID2
Gene Name: PCI domain containing 2

There are no transcripts associated with this gene.

Gene: PROZ
Gene Name: protein Z, vitamin K dependent plasma glycoprotein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001256134.1	20	Missense Mutation	ATC,GTC	I5V	NP_001243063.1
NM_003891.2	20	Missense Mutation	ATC,GTC	I5V	NP_003882.1
XM_017020812.1	20	Missense Mutation	ATC,GTC	I50V	XP_016876301.1
XM_017020813.1	20	Missense Mutation	ATC,GTC	I5V	XP_016876302.1

View Full Product Details