Product Details

SNP ID: rs201072008
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:568340 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGGCAGCCCTTGGGAGTGGCCTGTG[C/T]ACCCCAGGGCCAGCTCCTGGTGGCT
Phenotype: MIM: 605754
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: LOC107987233 PubMed Links

Gene Details

Gene: LOC107987233
Gene Name: uncharacterized LOC107987233

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
XM_017023921.1	926	Intron			XP_016879410.1

Gene: NHLRC4
Gene Name: NHL repeat containing 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001301159.1	926	Missense Mutation	GCA,GTA	A98V	NP_001288088.1
NM_176677.2	926	Missense Mutation	GCA,GTA	A98V	NP_788850.1

Gene: PIGQ
Gene Name: phosphatidylinositol glycan anchor biosynthesis class Q

There are no transcripts associated with this gene.

Gene: PRR35
Gene Name: proline rich 35

There are no transcripts associated with this gene.

View Full Product Details