Product Details

SNP ID: rs201073485
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:67930216 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CGAGGAGGCACCTGCGCCACCTGCA[C/T]AGATCATGGAGTCAGTGATACTTGA
Phenotype: MIM: 118888 MIM: 606967 MIM: 177015 MIM: 176847
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CTRL PubMed Links

Gene Details

Gene: CTRL
Gene Name: chymotrypsin like

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001907.2	625	Missense Mutation	TAT,TGT	Y201C	NP_001898.1

Gene: LCAT
Gene Name: lecithin-cholesterol acyltransferase

There are no transcripts associated with this gene.

Gene: PSKH1
Gene Name: protein serine kinase H1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_006742.2	625	Intron			NP_006733.1

Gene: PSMB10
Gene Name: proteasome subunit beta 10

There are no transcripts associated with this gene.

View Full Product Details