Product Details

SNP ID: rs199923657
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:81912611 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCGCCAGTGAGAAAATGGGATCCTG[C/G]CACCTGCCAAAAAGGGAAAGCGGCA
Phenotype: MIM: 602020 MIM: 607996 MIM: 602679 MIM: 606212
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: MAFG PubMed Links

Gene Details

Gene: MAFG
Gene Name: MAF bZIP transcription factor G

There are no transcripts associated with this gene.

Gene: NPB
Gene Name: neuropeptide B

There are no transcripts associated with this gene.

Gene: PCYT2
Gene Name: phosphate cytidylyltransferase 2, ethanolamine

There are no transcripts associated with this gene.

Gene: SIRT7
Gene Name: sirtuin 7

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_016538.2	2662	Missense Mutation	TGC,TGG	C336W	NP_057622.1
XM_006722284.2	2662	Missense Mutation	TGC,TGG	C254W	XP_006722347.1
XM_011523580.1	2662	Missense Mutation	TGC,TGG	C301W	XP_011521882.1
XM_011523581.2	2662	Missense Mutation	TGC,TGG	C265W	XP_011521883.1

View Full Product Details