Product Details

SNP ID: rs201846516
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:75131097 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CAGCAGGGGGCTGGTGCAGATGAAG[A/G]CCTGCGTGCTGCGGAGAAGGACGCG
Phenotype: MIM: 191720
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ARMC7 PubMed Links

Gene Details

Gene: ARMC7
Gene Name: armadillo repeat containing 7

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001304271.1	372	Intron			NP_001291200.1
NM_001304272.1	372	Intron			NP_001291201.1
NM_001304273.1	372	Intron			NP_001291202.1
NM_024585.3	372	Intron			NP_078861.1

Gene: HN1
Gene Name: hematological and neurological expressed 1

There are no transcripts associated with this gene.

Gene: NT5C
Gene Name: 5', 3'-nucleotidase, cytosolic

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001252377.1	372	Missense Mutation	GCC,GTC	A95V	NP_001239306.1
NM_014595.2	372	Missense Mutation	GCC,GTC	A95V	NP_055410.1
XM_011524700.2	372	Intron			XP_011523002.2

View Full Product Details