Product Details

SNP ID: rs202244473
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:7236469 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGGGGGCCGGGAGGTATGTGTCAGG[A/G]ATGTGGGGGACAAAGGAGATGCCAC
Phenotype: MIM: 610684 MIM: 602151 MIM: 605125 MIM: 612910
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CTDNEP1 PubMed Links

Gene Details

Gene: CTDNEP1
Gene Name: CTD nuclear envelope phosphatase 1

There are no transcripts associated with this gene.

Gene: DVL2
Gene Name: dishevelled segment polarity protein 2

There are no transcripts associated with this gene.

Gene: GABARAP
Gene Name: GABA type A receptor-associated protein

There are no transcripts associated with this gene.

Gene: PHF23
Gene Name: PHD finger protein 23

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001284517.1	484	Missense Mutation	TCC,TTC	S86F	NP_001271446.1
NM_001284518.1	484	Missense Mutation	TCC,TTC	S149F	NP_001271447.1
NM_024297.2	484	Missense Mutation	TCC,TTC	S153F	NP_077273.2

View Full Product Details