Product Details

SNP ID: rs201904488
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:35983833 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCCTTCATGTCCTTGATATAGTCCT[A/G]GACCCACTTGTCACTGGGGTTGGTA
Phenotype: MIM: 601392 MIM: 601394
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CCL14 PubMed Links

Gene Details

Gene: CCL14
Gene Name: C-C motif chemokine ligand 14

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_032962.4	377	Nonsense Mutation	CAG,TAG	Q100*	NP_116738.1
NM_032963.3	377	Nonsense Mutation	CAG,TAG	Q84*	NP_116739.1

Gene: CCL15-CCL14
Gene Name: CCL15-CCL14 readthrough (NMD candidate)

There are no transcripts associated with this gene.

Gene: CCL16
Gene Name: C-C motif chemokine ligand 16

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_004590.3	377	Intron			NP_004581.1
XM_005258020.4	377	Intron			XP_005258077.1

Gene: LOC101927339
Gene Name: uncharacterized LOC101927339

There are no transcripts associated with this gene.

View Full Product Details