Product Details

SNP ID: rs201535986
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:7855566 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTCGTGCTTGCTCTGGCCAGCTACC[A/G]CCGCCTCTGCCTGCGCCTCCGCCTA
Phenotype: MIM: 611577
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CYB5D1 PubMed Links

Gene Details

Gene: CYB5D1
Gene Name: cytochrome b5 domain containing 1

There are no transcripts associated with this gene.

Gene: KDM6B
Gene Name: lysine demethylase 6B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001080424.1	341	Intron			NP_001073893.1
XM_005256549.3	341	Intron			XP_005256606.1
XM_005256550.4	341	Intron			XP_005256607.1
XM_005256551.3	341	Intron			XP_005256608.1
XM_005256552.4	341	Intron			XP_005256609.1
XM_006721483.3	341	Intron			XP_006721546.1
XM_011523750.2	341	Intron			XP_011522052.1
XM_011523752.2	341	Intron			XP_011522054.1
XM_017024381.1	341	Intron			XP_016879870.1

Gene: NAA38
Gene Name: N(alpha)-acetyltransferase 38, NatC auxiliary subunit

There are no transcripts associated with this gene.

Gene: TMEM88
Gene Name: transmembrane protein 88

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001319941.1	341	Intron			NP_001306870.1
NM_203411.1	341	Missense Mutation	CAC,CGC	H111R	NP_981956.1
XM_005256856.3	341	Missense Mutation	CAC,CGC	H125R	XP_005256913.1

View Full Product Details