Product Details

SNP ID: rs199690352
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:55159192 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCAGGGCTCACAGTGTGGGGTCCCA[C/T]CCTGCAGAGGCTGGGTCAGGCCCTC
Phenotype: MIM: 614566 MIM: 191044 MIM: 191041
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: DNAAF3 PubMed Links

Gene Details

Gene: DNAAF3
Gene Name: dynein axonemal assembly factor 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001256714.1	1711	Missense Mutation	GAT,GGT	D566G	NP_001243643.1
NM_001256715.1	1711	Missense Mutation	GAT,GGT	D499G	NP_001243644.1
NM_001256716.1	1711	Missense Mutation	GAT,GGT	D445G	NP_001243645.1
NM_178837.4	1711	Missense Mutation	GAT,GGT	D546G	NP_849159.2

Gene: TNNI3
Gene Name: troponin I3, cardiac type

There are no transcripts associated with this gene.

Gene: TNNT1
Gene Name: troponin T1, slow skeletal type

There are no transcripts associated with this gene.

View Full Product Details