Product Details

SNP ID: rs201832670
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:54108033 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGTTCCCGCCTTCCTCACCTGCACC[A/G]GGGCCAGCTCTGGAGTCAGCGCATT
Phenotype: MIM: 603832 MIM: 606862 MIM: 606419 MIM: 609519
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: NDUFA3 PubMed Links

Gene Details

Gene: NDUFA3
Gene Name: NADH:ubiquinone oxidoreductase subunit A3

There are no transcripts associated with this gene.

Gene: OSCAR
Gene Name: osteoclast associated, immunoglobulin-like receptor

There are no transcripts associated with this gene.

Gene: PRPF31
Gene Name: pre-mRNA processing factor 31

There are no transcripts associated with this gene.

Gene: TFPT
Gene Name: TCF3 fusion partner

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001321792.1	647	Missense Mutation	CCG,CTG	P203L	NP_001308721.1
NM_013342.3	647	Missense Mutation	CCG,CTG	P212L	NP_037474.1
XM_005278261.1	647	Missense Mutation	CCG,CTG	P92L	XP_005278318.1

View Full Product Details