Product Details

SNP ID

rs201951170

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.19:44172110 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

TAGGAAGCAGTGACCTTCAAGGACG[C/T]GGCTGTGGCCTTCACGGAGGAGGAA

Phenotype

Polymorphism

C/T, Transition Substitution

Allele Nomenclature

Literature Links

ZNF226 PubMed Links

Additional Information

For this assay, SNP(s) [rs2232801] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

ZNF226

Gene Name

zinc finger protein 226

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001032372.1	343	Missense Mutation	GCG,GTG	A13V	NP_001027544.1
NM_001032373.1	343	Missense Mutation	GCG,GTG	A13V	NP_001027545.1
NM_001032374.1	343	Missense Mutation	GCG,GTG	A13V	NP_001027546.1
NM_001146220.2	343	Missense Mutation	GCG,GTG	A13V	NP_001139692.1
NM_001319088.1	343	Missense Mutation	GCG,GTG	A13V	NP_001306017.1
NM_001319089.1	343	Missense Mutation	GCG,GTG	A13V	NP_001306018.1
NM_001319090.1	343	Missense Mutation	GCG,GTG	A13V	NP_001306019.1
NM_015919.3	343	Missense Mutation	GCG,GTG	A13V	NP_057003.2
NM_016444.2	343	Missense Mutation	GCG,GTG	A13V	NP_057528.2
XM_005259227.2	343	Missense Mutation	GCG,GTG	A13V	XP_005259284.1
XM_006723367.3	343	Missense Mutation	GCG,GTG	A13V	XP_006723430.1
XM_006723368.3	343	Missense Mutation	GCG,GTG	A13V	XP_006723431.1
XM_006723369.2	343	Missense Mutation	GCG,GTG	A13V	XP_006723432.1
XM_017027262.1	343	Missense Mutation	GCG,GTG	A13V	XP_016882751.1
XM_017027263.1	343	UTR 5			XP_016882752.1
XM_017027264.1	343	UTR 5			XP_016882753.1
XM_017027265.1	343	Missense Mutation	GCG,GTG	A13V	XP_016882754.1

View Full Product Details