Product Details

SNP ID: rs201006442
Assay Type: Functionally tested
NCBI dbSNP Submissions: 15
Location: Chr.1:42851253 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CAAAACCTTCAATAATACCTCCAAC[C/G]TGAGAACACACCAGCGGATCCACAC
Phenotype: MIM: 609017
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: ERMAP PubMed Links

Gene Details

Gene: ERMAP
Gene Name: erythroblast membrane associated protein (Scianna blood group)

There are no transcripts associated with this gene.

Gene: LOC339539
Gene Name: uncharacterized LOC339539

There are no transcripts associated with this gene.

Gene: ZNF691
Gene Name: zinc finger protein 691

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001242739.1	4372	Silent Mutation	CTG,GTG	L130V	NP_001229668.1
NM_015911.3	4372	Silent Mutation	CTG,GTG	L99V	NP_056995.1
XM_006710671.3	4372	Missense Mutation	CTG,GTG	L126V	XP_006710734.1
XM_017001400.1	4372	Missense Mutation	CTG,GTG	L130V	XP_016856889.1
XM_017001401.1	4372	Missense Mutation	CTG,GTG	L130V	XP_016856890.1
XM_017001402.1	4372	Missense Mutation	CTG,GTG	L121V	XP_016856891.1
XM_017001403.1	4372	Missense Mutation	CTG,GTG	L121V	XP_016856892.1

View Full Product Details