Product Details

SNP ID: rs200501029
Assay Type: Functionally tested
NCBI dbSNP Submissions: 4
Location: Chr.1:37799900 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCAACAACCTCATGTTCATCCCCAG[C/T]GTGGGGCCTGGCTACATAGACACCA
Phenotype: MIM: 600172 MIM: 612276
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: C1orf122 PubMed Links

Gene Details

Gene: C1orf122
Gene Name: chromosome 1 open reading frame 122

There are no transcripts associated with this gene.

Gene: MANEAL
Gene Name: mannosidase endo-alpha like

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001031740.2	693	UTR 3			NP_001026910.1
NM_001113482.1	693	Silent Mutation	AGC,AGT	S357S	NP_001106954.1
NM_152496.2	693	Silent Mutation	AGC,AGT	S135S	NP_689709.1
XM_005270510.3	693	Silent Mutation	AGC,AGT	S239S	XP_005270567.1
XM_011540788.1	693	Silent Mutation	AGC,AGT	S135S	XP_011539090.1

Gene: MTF1
Gene Name: metal regulatory transcription factor 1

There are no transcripts associated with this gene.

Gene: YRDC
Gene Name: yrdC N6-threonylcarbamoyltransferase domain containing

There are no transcripts associated with this gene.

View Full Product Details