Product Details

SNP ID

rs200528946

Assay Type

Functionally Tested

NCBI dbSNP Submissions

3

Location

Chr.1:151090456 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

CAGCTCAATATGGTCATTATTCCAC[A/C]GCAGAAGTACTCCTTCGAGCAGGTG

Phenotype

Polymorphism

A/C, Transversion Substitution

Allele Nomenclature

Literature Links

GABPB2 PubMed Links

Additional Information

For this assay, SNP(s) [rs11204774] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

GABPB2

Gene Name

GA binding protein transcription factor beta subunit 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001323906.1	490	Silent Mutation	ACA,ACC	T53T	NP_001310835.1
NM_001323907.1	490	Intron			NP_001310836.1
NM_001323908.1	490	Silent Mutation	ACA,ACC	T53T	NP_001310837.1
NM_001323909.1	490	Silent Mutation	ACA,ACC	T53T	NP_001310838.1
NM_001323910.1	490	Silent Mutation	ACA,ACC	T69T	NP_001310839.1
NM_001323911.1	490	Silent Mutation	ACA,ACC	T53T	NP_001310840.1
NM_001323912.1	490	Intron			NP_001310841.1
NM_001323913.1	490	Intron			NP_001310842.1
NM_144618.2	490	Silent Mutation	ACA,ACC	T53T	NP_653219.1
XM_017000246.1	490	Silent Mutation	ACA,ACC	T69T	XP_016855735.1
XM_017000247.1	490	Silent Mutation	ACA,ACC	T69T	XP_016855736.1
XM_017000248.1	490	Silent Mutation	ACA,ACC	T65T	XP_016855737.1
XM_017000249.1	490	Silent Mutation	ACA,ACC	T53T	XP_016855738.1
XM_017000250.1	490	Silent Mutation	ACA,ACC	T69T	XP_016855739.1
XM_017000251.1	490	Silent Mutation	ACA,ACC	T65T	XP_016855740.1
XM_017000252.1	490	Intron			XP_016855741.1
XM_017000253.1	490	Silent Mutation	ACA,ACC	T69T	XP_016855742.1
XM_017000254.1	490	Intron			XP_016855743.1

View Full Product Details