Product Details
- SNP ID
-
rs202240934
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
3
- Location
-
Chr.1:26282410 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- GGCCGGGACCGGGACCGGGACAGGG[A/G]CCAGGACTGAATTTCAGGCTGGACT
- Phenotype
-
MIM: 615679
MIM: 609151
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
CEP85
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs146441030,rs34209692] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- CEP85
- Gene Name
- centrosomal protein 85
There are no transcripts associated with this gene.
- Gene
- SH3BGRL3
- Gene Name
- SH3 domain binding glutamate rich protein like 3
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_031286.3 |
1240 |
Intron |
|
|
NP_112576.1 |
- Gene
- UBXN11
- Gene Name
- UBX domain protein 11
View Full Product Details