Product Details

SNP ID: rs199925077
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:219549780 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTCCCTGAGCTCCTTCATGGCCTCA[A/C]CCACAGATGCGGACTATGAGTATGG
Phenotype: MIM: 610405 MIM: 610991
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: CHPF PubMed Links

Gene Details

Gene: CHPF
Gene Name: chondroitin polymerizing factor

There are no transcripts associated with this gene.

Gene: MIR3132
Gene Name: microRNA 3132

There are no transcripts associated with this gene.

Gene: OBSL1
Gene Name: obscurin like 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001173408.1	1420	Intron			NP_001166879.1
NM_001173431.1	1420	Intron			NP_001166902.1
NM_015311.2	1420	Intron			NP_056126.1
XM_005246424.4	1420	Intron			XP_005246481.1
XM_005246427.4	1420	Intron			XP_005246484.1
XM_011510857.2	1420	Intron			XP_011509159.1
XM_011510863.2	1420	Intron			XP_011509165.1
XM_011510864.2	1420	Intron			XP_011509166.1
XM_011510865.2	1420	Intron			XP_011509167.1
XM_011510866.2	1420	Intron			XP_011509168.1
XM_017003696.1	1420	Intron			XP_016859185.1
XM_017003697.1	1420	Intron			XP_016859186.1
XM_017003698.1	1420	Intron			XP_016859187.1
XM_017003699.1	1420	Intron			XP_016859188.1
XM_017003700.1	1420	Intron			XP_016859189.1

Gene: TMEM198
Gene Name: transmembrane protein 198

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001005209.2	1420	Missense Mutation	ACC,CCC	T337P	NP_001005209.1
NM_001303098.1	1420	Missense Mutation	ACC,CCC	T337P	NP_001290027.1
XM_017003367.1	1420	Missense Mutation	ACC,CCC	T337P	XP_016858856.1

View Full Product Details