Product Details

SNP ID: rs200289214
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:50286754 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGGCGTTTTGCCGCCGTCACTGTGT[G/T]CCCAGGCTGGCTGCAGCCCTGTGTA
Phenotype: MIM: 604038 MIM: 602725 MIM: 607073 MIM: 601281
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: HYAL3 PubMed Links

Gene Details

Gene: HYAL3
Gene Name: hyaluronoglucosaminidase 3

There are no transcripts associated with this gene.

Gene: IFRD2
Gene Name: interferon related developmental regulator 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_006764.4	337	Intron			NP_006755.4

Gene: LSMEM2
Gene Name: leucine rich single-pass membrane protein 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001304385.1	337	Missense Mutation	GCC,TCC	A84S	NP_001291314.1
NM_153215.2	337	Missense Mutation	GCC,TCC	A85S	NP_694947.1
XM_006712979.3	337	Missense Mutation	GCC,TCC	A94S	XP_006713042.1
XM_006712980.3	337	Missense Mutation	GCC,TCC	A93S	XP_006713043.1
XM_011533370.2	337	Missense Mutation	GCC,TCC	A61S	XP_011531672.1

Gene: NAT6
Gene Name: N-acetyltransferase 6

There are no transcripts associated with this gene.

Gene: SEMA3B
Gene Name: semaphorin 3B

There are no transcripts associated with this gene.

View Full Product Details