Product Details

SNP ID: rs200500263
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:31728716 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTATTTCCACAATTCGGAGCCCCAG[A/G]TCTTGCAGGGCTTTGCGGACTCCAT
Phenotype: MIM: 606520 MIM: 602872 MIM: 604744 MIM: 610435
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: C6orf25 PubMed Links

Gene Details

Gene: C6orf25
Gene Name: chromosome 6 open reading frame 25

There are no transcripts associated with this gene.

Gene: CLIC1
Gene Name: chloride intracellular channel 1

There are no transcripts associated with this gene.

Gene: DDAH2
Gene Name: dimethylarginine dimethylaminohydrolase 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001303007.1	531	Silent Mutation	GAC,GAT	D109D	NP_001289936.1
NM_001303008.1	531	Silent Mutation	GAC,GAT	D109D	NP_001289937.1
NM_013974.2	531	Silent Mutation	GAC,GAT	D109D	NP_039268.1
XM_011514448.2	531	Silent Mutation	GAC,GAT	D109D	XP_011512750.1

Gene: LY6G6C
Gene Name: lymphocyte antigen 6 complex, locus G6C

There are no transcripts associated with this gene.

View Full Product Details