Product Details

SNP ID: rs200939375
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.9:35813075 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGGTTCAACCTGGAGGCCACTGGAG[C/G]TGCCGGCCCCCAAGTACATGAATGT
Phenotype: MIM: 609997 MIM: 108961 MIM: 605731
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: FAM221B PubMed Links

Gene Details

Gene: FAM221B
Gene Name: family with sequence similarity 221 member B

There are no transcripts associated with this gene.

Gene: HINT2
Gene Name: histidine triad nucleotide binding protein 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_032593.2	537	Missense Mutation	CAC,CAG	H157Q	NP_115982.1

Gene: NPR2
Gene Name: natriuretic peptide receptor 2

There are no transcripts associated with this gene.

Gene: SPAG8
Gene Name: sperm associated antigen 8

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001039592.1	537	Intron			NP_001034681.1
NM_172312.1	537	Intron			NP_758516.1

View Full Product Details