Product Details

SNP ID: hCV11656518
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.20:45899874 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGTGCAGAATGGTTGGAATAGATTC[A/G]GAACCTGCGGGAAAGAAAGGAGCCC
Phenotype: MIM: 613111 MIM: 608597 MIM: 172425
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CTSA PubMed Links

Gene Details

Gene: CTSA
Gene Name: cathepsin A

There are no transcripts associated with this gene.

Gene: NEURL2
Gene Name: neuralized E3 ubiquitin protein ligase 2

There are no transcripts associated with this gene.

Gene: PLTP
Gene Name: phospholipid transfer protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001242920.1	1192	Nonsense Mutation	CGA,TGA	R299*	NP_001229849.1
NM_001242921.1	1192	Nonsense Mutation	CGA,TGA	R306*	NP_001229850.1
NM_006227.3	1192	Nonsense Mutation	CGA,TGA	R394*	NP_006218.1
NM_182676.2	1192	Nonsense Mutation	CGA,TGA	R342*	NP_872617.1

View Full Product Details