Product Details

SNP ID: rs2305796
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:12843327 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GGGACCGTGGGGAGGAGAGTGGAGA[C/T]GGATCCTCCCTCCAATTCCCGGTGC
Phenotype: MIM: 612256 MIM: 609553
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: MAST1 PubMed Links

Gene Details

Gene: MAST1
Gene Name: microtubule associated serine/threonine kinase 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_014975.2		Intron			NP_055790.1
XM_011527805.2		Intron			XP_011526107.1
XM_011527808.2		Intron			XP_011526110.1
XM_017026501.1		Intron			XP_016881990.1

Gene: MIR6794
Gene Name: microRNA 6794

There are no transcripts associated with this gene.

Gene: RTBDN
Gene Name: retbindin

There are no transcripts associated with this gene.

View Full Product Details