Product Details

SNP ID: rs747801
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.8:22040962 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GAAGTGACCTGAAGGATCCGCAGGG[A/G]GAAAGCAGAGAGGTGGGCACGCGGG
Phenotype: MIM: 125305 MIM: 603725 MIM: 608073
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: DMTN PubMed Links

Gene Details

Gene: DMTN
Gene Name: dematin actin binding protein

There are no transcripts associated with this gene.

Gene: FGF17
Gene Name: fibroblast growth factor 17

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001304478.1	959	Intron			NP_001291407.1
NM_003867.3	959	Intron			NP_003858.1
XM_005273675.1	959	Intron			XP_005273732.1
XM_011544683.1	959	UTR 5			XP_011542985.1
XM_011544684.2	959	UTR 5			XP_011542986.1
XM_011544685.1	959	UTR 5			XP_011542987.1

Gene: NPM2
Gene Name: nucleophosmin/nucleoplasmin 2

There are no transcripts associated with this gene.

View Full Product Details