Product Details

SNP ID

rs36043491

Assay Type

DME

NCBI dbSNP Submissions

NA

Location

Chr.16:28605865 on Build GRCh38

Set Membership

DME Validated Inventoried

Context Sequence [VIC/FAM]

CTGAGGCTGCAGCCTGCCATCTTCT[T/C]CGCATAGTCCGCATCGAAGCGCTCA

Phenotype

MIM: 171150 MIM: 601292

Polymorphism

T/C, Transition substitution

Allele Nomenclature

Literature Links

SULT1A1 PubMed Links

Additional Information

The SULT1A1 gene exhibits copy number variation. Individuals may carry deletion alleles or extra copies of SULT1A1. SULT1A1 SNP genotyping assays run on samples having 2 or more gene copies that are homozygous for the SNP allele will cluster together, and samples having more than 2 gene copies that are heterozygous may run between the 2 copy heterozygous and homozygous clusters. For accurate SULT1A1 genotype analysis, copy number analysis must be done. For more information, refer to the PGx Experiments User Guide (Pub. # MAN0009612) Chapter 2 Copy Number Variation section.

Gene Details

Gene

SULT1A1

Gene Name

sulfotransferase family 1A member 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001055.3	1274	Missense Mutation	AAG,GAG	K282E	NP_001046.2
NM_177529.2	1274	Missense Mutation	AAG,GAG	K282E	NP_803565.1
NM_177530.2	1274	Missense Mutation	AAG,GAG	K282E	NP_803566.1
NM_177534.2	1274	Missense Mutation	AAG,GAG	K282E	NP_803878.1
NM_177536.3	1274	Missense Mutation	AAG,GAG	K204E	NP_803880.1
XM_017023604.1	1274	Missense Mutation	AAG,GAG	K288E	XP_016879093.1
XM_017023605.1	1274	Missense Mutation	AAG,GAG	K288E	XP_016879094.1
XM_017023606.1	1274	Missense Mutation	AAG,GAG	K282E	XP_016879095.1
XM_017023607.1	1274	Missense Mutation	AAG,GAG	K373E	XP_016879096.1
XM_017023608.1	1274	Missense Mutation	AAG,GAG	K288E	XP_016879097.1
XM_017023609.1	1274	Missense Mutation	AAG,GAG	K288E	XP_016879098.1
XM_017023610.1	1274	Missense Mutation	AAG,GAG	K288E	XP_016879099.1
XM_017023611.1	1274	Missense Mutation	AAG,GAG	K282E	XP_016879100.1
XM_017023612.1	1274	Missense Mutation	AAG,GAG	K282E	XP_016879101.1
XM_017023613.1	1274	Missense Mutation	AAG,GAG	K282E	XP_016879102.1

Gene

SULT1A2

Gene Name

sulfotransferase family 1A member 2

There are no transcripts associated with this gene.

View Full Product Details