Product Details

SNP ID: rs14075
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:7235285 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GAAGAAAAGATGAGGGAGGGGAGTG[C/T]TAATATTTACACTAGAGTTTTATAG
Phenotype: MIM: 610684 MIM: 602151 MIM: 605125 MIM: 612910
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CTDNEP1 PubMed Links

Gene Details

Gene: CTDNEP1
Gene Name: CTD nuclear envelope phosphatase 1

There are no transcripts associated with this gene.

Gene: DVL2
Gene Name: dishevelled segment polarity protein 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_004422.2	1579	Intron			NP_004413.1
XM_005256502.1	1579	Intron			XP_005256559.1
XM_017024298.1	1579	Intron			XP_016879787.1

Gene: GABARAP
Gene Name: GABA type A receptor-associated protein

There are no transcripts associated with this gene.

Gene: PHF23
Gene Name: PHD finger protein 23

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001284517.1	1579	UTR 3			NP_001271446.1
NM_001284518.1	1579	UTR 3			NP_001271447.1
NM_024297.2	1579	UTR 3			NP_077273.2

View Full Product Details