Product Details

SNP ID: rs15015
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.7:100092976 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTCCGGGAAGCATTGACCTGCCAGA[A/C]ATTGAGCTCCTCATATTCATCCAGA
Phenotype: MIM: 602296 MIM: 614729 MIM: 600592 MIM: 612983 MIM: 612150 MIM: 612984
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: AP4M1 PubMed Links

Gene Details

Gene: AP4M1
Gene Name: adaptor related protein complex 4 mu 1 subunit

There are no transcripts associated with this gene.

Gene: COPS6
Gene Name: COP9 signalosome subunit 6

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_006833.4	2762	Intron			NP_006824.2

Gene: MCM7
Gene Name: minichromosome maintenance complex component 7

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001278595.1	2762	Missense Mutation			NP_001265524.1
NM_005916.4	2762	Missense Mutation			NP_005907.3
NM_182776.2	2762	Missense Mutation			NP_877577.1
XM_005250348.3	2762	Missense Mutation			XP_005250405.1
XM_017012217.1	2762	Missense Mutation			XP_016867706.1

Gene: MIR106B
Gene Name: microRNA 106b

There are no transcripts associated with this gene.

Gene: MIR25
Gene Name: microRNA 25

There are no transcripts associated with this gene.

Gene: MIR93
Gene Name: microRNA 93

There are no transcripts associated with this gene.

View Full Product Details