Product Details

SNP ID: rs2178395
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:54344066 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CAGTTATCTGATGTGGTTCAACCTA[A/G]TAACTTTCTCAGGGTCACACATGTA
Phenotype: MIM: 615472 MIM: 613787
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: COPZ1 PubMed Links

Gene Details

Gene: COPZ1
Gene Name: coatomer protein complex subunit zeta 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001271734.1		Intron			NP_001258663.1
NM_001271735.1		Intron			NP_001258664.1
NM_001271736.1		Intron			NP_001258665.1
NM_016057.2		Intron			NP_057141.1
XM_017018997.1		Intron			XP_016874486.1

Gene: LOC102724050
Gene Name: uncharacterized LOC102724050

There are no transcripts associated with this gene.

Gene: MIR148B
Gene Name: microRNA 148b

There are no transcripts associated with this gene.

View Full Product Details