Product Details

SNP ID: rs2067606
Assay Type: Validated
NCBI dbSNP Submissions: 62
Location: Chr.1:151156778 on Build GRCh38
Set Membership: HapMap Validated
Context Sequence [VIC/FAM]: CTTTAGGGGTAATGGTGGCAGAGGA[A/G]TCTCTAGCTCTTTCAGTCTTAGCTT
Phenotype: MIM: 608095 MIM: 609294 MIM: 612112
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: LYSMD1 PubMed Links

Gene Details

Gene: LYSMD1
Gene Name: LysM domain containing 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001136543.1		Intron			NP_001130015.1
NM_212551.4		Intron			NP_997716.1

Gene: SCNM1
Gene Name: sodium channel modifier 1

There are no transcripts associated with this gene.

Gene: SEMA6C
Gene Name: semaphorin 6C

There are no transcripts associated with this gene.

Gene: TNFAIP8L2
Gene Name: TNF alpha induced protein 8 like 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_024575.4		Intron			NP_078851.2

Gene: TNFAIP8L2-SCNM1
Gene Name: TNFAIP8L2-SCNM1 readthrough

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001204848.1		Intron			NP_001191777.1

View Full Product Details