Product Details

SNP ID: rs2233456
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:67174059 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GGCTGGGATCGAGGTGAACTTAAAC[C/T]CCAGCCTGGGTGTTCACTGGGGGCA
Phenotype: MIM: 609077 MIM: 602438 MIM: 605235
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: FBXL8 PubMed Links

Gene Details

Gene: FBXL8
Gene Name: F-box and leucine rich repeat protein 8

There are no transcripts associated with this gene.

Gene: HSF4
Gene Name: heat shock transcription factor 4

There are no transcripts associated with this gene.

Gene: KIAA0895L
Gene Name: KIAA0895 like

There are no transcripts associated with this gene.

Gene: NOL3
Gene Name: nucleolar protein 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001185057.2		Intron			NP_001171986.1
NM_001276307.1		Intron			NP_001263236.1
NM_001276309.1		Intron			NP_001263238.1
NM_001276311.1		Intron			NP_001263240.1
NM_001276312.1		Intron			NP_001263241.1
NM_001276319.1		Intron			NP_001263248.1
NM_003946.6		Intron			NP_003937.1
XM_005256217.2		Intron			XP_005256274.1
XM_005256219.3		Intron			XP_005256276.1
XM_011523424.2		Intron			XP_011521726.1
XM_017023843.1		Intron			XP_016879332.1

View Full Product Details