Product Details

SNP ID: rs2233827
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.20:31475835 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TTACAGTCGGGTTACCCCCATACCC[C/T]CCTCGCGCTTCTGGAGTGCCAACCC
Phenotype: MIM: 610388
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: DEFB124 PubMed Links

Gene Details

Gene: DEFB124
Gene Name: defensin beta 124

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001037500.1		Intron			NP_001032589.1
XM_017027782.1		Intron			XP_016883271.1

Gene: LINC00028
Gene Name: long intergenic non-protein coding RNA 28

There are no transcripts associated with this gene.

Gene: REM1
Gene Name: RRAD and GEM like GTPase 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_014012.5		Intron			NP_054731.2
XM_005260404.1		Intron			XP_005260461.1
XM_011528795.1		Intron			XP_011527097.1
XM_017027833.1		Intron			XP_016883322.1

View Full Product Details