Product Details

SNP ID: rs3087989
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.13:45338740 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCCTCACGGTAGTCCAATAGAGCAA[A/C]CATGCCATCTGGATTCATGTTTTCA
Phenotype: MIM: 600763
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: SNORA31 PubMed Links

Gene Details

Gene: SNORA31
Gene Name: small nucleolar RNA, H/ACA box 31

There are no transcripts associated with this gene.

Gene: TPT1
Gene Name: tumor protein, translationally-controlled 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001286272.1	651	Missense Mutation	GTT,TTT	V146F	NP_001273201.1
NM_001286273.1	651	Missense Mutation	GTT,TTT	V112F	NP_001273202.1
NM_003295.3	651	Missense Mutation	GTT,TTT	V146F	NP_003286.1

Gene: TPT1-AS1
Gene Name: TPT1 antisense RNA 1

There are no transcripts associated with this gene.

View Full Product Details