Product Details

SNP ID: rs2073776
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.22:19037138 on Build GRCh38
Set Membership: HapMap Validated
Context Sequence [VIC/FAM]: GTCCTCTGCAGCCAGTAGGGGACTC[T/C]TGTGGCCAGGACTTCCTTGTTAAGT
Phenotype: MIM: 600594
Polymorphism: T/C, Transition substitution
Allele Nomenclature
Literature Links: DGCR11 PubMed Links

Gene Details

Gene: DGCR11
Gene Name: DiGeorge syndrome critical region gene 11 (non-protein coding)

There are no transcripts associated with this gene.

Gene: DGCR2
Gene Name: DiGeorge syndrome critical region gene 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001173533.1	3505	UTR 3			NP_001167004.1
NM_001173534.1	3505	UTR 3			NP_001167005.1
NM_001184781.1	3505	UTR 3			NP_001171710.1
NM_005137.2	3505	UTR 3			NP_005128.1

Gene: DGCR5
Gene Name: DiGeorge syndrome critical region gene 5 (non-protein coding)

There are no transcripts associated with this gene.

View Full Product Details