Product Details

SNP ID: rs2298209
Assay Type: Functionally tested
NCBI dbSNP Submissions: 24
Location: Chr.1:1211405 on Build GRCh38
Set Membership: HapMap JSNP
Context Sequence [VIC/FAM]: GAGGTATGCATGGCATACGTAAGCA[C/G]AGAGCCGGAGGCAGCCATCGGCACC
Phenotype: MIM: 614282 MIM: 603905 MIM: 600315
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: SDF4 PubMed Links

Gene Details

Gene: SDF4
Gene Name: stromal cell derived factor 4

There are no transcripts associated with this gene.

Gene: TNFRSF18
Gene Name: TNF receptor superfamily member 18

There are no transcripts associated with this gene.

Gene: TNFRSF4
Gene Name: TNF receptor superfamily member 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_003327.3	1457	UTR 3			NP_003318.1
XM_011542074.2	1457	UTR 3			XP_011540376.1
XM_011542075.2	1457	UTR 3			XP_011540377.1
XM_011542076.2	1457	UTR 3			XP_011540378.1
XM_011542077.2	1457	UTR 3			XP_011540379.1
XM_017002231.1	1457	UTR 3			XP_016857720.1
XM_017002232.1	1457	UTR 3			XP_016857721.1

View Full Product Details