Product Details

SNP ID: rs2306125
Assay Type: Functionally tested
NCBI dbSNP Submissions: 34
Location: Chr.1:155052885 on Build GRCh38
Set Membership: HapMap JSNP
Context Sequence [VIC/FAM]: TGAGGAGCTGGTGGGTAGAGCTCAC[C/T]GTAGTGGGTCTATCCCAGGCCCAGC
Phenotype: MIM: 605548
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ADAM15 PubMed Links

Gene Details

Gene: ADAM15
Gene Name: ADAM metallopeptidase domain 15

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001261464.1		Intron			NP_001248393.1
NM_001261465.1		Intron			NP_001248394.1
NM_001261466.1		Intron			NP_001248395.1
NM_003815.4		Intron			NP_003806.3
NM_207191.2		Intron			NP_997074.1
NM_207194.2		Intron			NP_997077.1
NM_207195.2		Intron			NP_997078.1
NM_207196.2		Intron			NP_997079.1
NM_207197.2		Intron			NP_997080.1

Gene: DCST1
Gene Name: DC-STAMP domain containing 1

There are no transcripts associated with this gene.

Gene: LOC100505666
Gene Name: uncharacterized LOC100505666

There are no transcripts associated with this gene.

View Full Product Details