Product Details

SNP ID

rs2531702

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.22:20019189 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

CTCATCCTCTCACCTAGCTCCATGC[A/G]GACAGCTGTGAGGCCCCCGGAGAAA

Phenotype

MIM: 602269 MIM: 616830

Polymorphism

A/G, Transition Substitution

Allele Nomenclature

Literature Links

ARVCF PubMed Links

Additional Information

For this assay, SNP(s) [rs74731343] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

ARVCF

Gene Name

armadillo repeat gene deleted in velocardiofacial syndrome

There are no transcripts associated with this gene.

Gene

TANGO2

Gene Name

transport and golgi organization 2 homolog

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001283106.2	202	UTR 5			NP_001270035.1
NM_001283116.2	202	Intron			NP_001270045.1
NM_001283129.2	202	Intron			NP_001270058.1
NM_001283148.2	202	Intron			NP_001270077.1
NM_001283154.2	202	Intron			NP_001270083.1
NM_001283179.2	202	Intron			NP_001270108.1
NM_001283186.2	202	Intron			NP_001270115.1
NM_001283199.2	202	Intron			NP_001270128.1
NM_001283215.2	202	Intron			NP_001270144.1
NM_001283235.2	202	Intron			NP_001270164.1
NM_001283248.2	202	Intron			NP_001270177.1
NM_001322141.1	202	Intron			NP_001309070.1
NM_001322142.1	202	Intron			NP_001309071.1
NM_001322143.1	202	Intron			NP_001309072.1
NM_001322144.1	202	Intron			NP_001309073.1
NM_001322145.1	202	Intron			NP_001309074.1
NM_001322146.1	202	Intron			NP_001309075.1
NM_001322147.1	202	Intron			NP_001309076.1
NM_001322148.1	202	Intron			NP_001309077.1
NM_001322149.1	202	Intron			NP_001309078.1
NM_001322150.1	202	Intron			NP_001309079.1
NM_001322153.1	202	Intron			NP_001309082.1
NM_001322155.1	202	Intron			NP_001309084.1
NM_001322160.1	202	Intron			NP_001309089.1
NM_001322163.1	202	UTR 5			NP_001309092.1
NM_001322166.1	202	Intron			NP_001309095.1
NM_001322167.1	202	Intron			NP_001309096.1
NM_001322169.1	202	Intron			NP_001309098.1
NM_001322171.1	202	Intron			NP_001309100.1
NM_001322172.1	202	Intron			NP_001309101.1
NM_001322173.1	202	Intron			NP_001309102.1
NM_001322174.1	202	Intron			NP_001309103.1
NM_001322175.1	202	Intron			NP_001309104.1
NM_152906.6	202	Intron			NP_690870.3
XM_011529863.1	202	Intron			XP_011528165.1
XM_011529865.1	202	Intron			XP_011528167.1
XM_011529867.1	202	UTR 5			XP_011528169.1
XM_017028577.1	202	Intron			XP_016884066.1
XM_017028578.1	202	Intron			XP_016884067.1
XM_017028579.1	202	Intron			XP_016884068.1
XM_017028580.1	202	UTR 5			XP_016884069.1
XM_017028581.1	202	Intron			XP_016884070.1
XM_017028582.1	202	UTR 5			XP_016884071.1
XM_017028583.1	202	Intron			XP_016884072.1
XM_017028584.1	202	Intron			XP_016884073.1
XM_017028585.1	202	Intron			XP_016884074.1
XM_017028586.1	202	Intron			XP_016884075.1
XM_017028587.1	202	Intron			XP_016884076.1
XM_017028588.1	202	Intron			XP_016884077.1

View Full Product Details