Product Details

SNP ID: rs13390639
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:66441268 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: ATAAACCTCTAGATGGTACCCAGTT[A/G]CTGCTATTAAGTTTTAGTGTTATTG
Phenotype: MIM: 601739
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: MEIS1 PubMed Links

Gene Details

Gene: MEIS1
Gene Name: Meis homeobox 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_002398.2		Intron			NP_002389.1
XM_005264321.2		Intron			XP_005264378.1
XM_005264322.2		Intron			XP_005264379.1
XM_005264323.2		Intron			XP_005264380.1
XM_005264324.4		Intron			XP_005264381.1
XM_005264325.4		Intron			XP_005264382.1
XM_017004141.1		Intron			XP_016859630.1
XM_017004142.1		Intron			XP_016859631.1
XM_017004143.1		Intron			XP_016859632.1
XM_017004144.1		Intron			XP_016859633.1
XM_017004145.1		Intron			XP_016859634.1
XM_017004146.1		Intron			XP_016859635.1

Gene: MEIS1-AS2
Gene Name: MEIS1 antisense RNA 2

There are no transcripts associated with this gene.

Gene: MEIS1-AS3
Gene Name: MEIS1 antisense RNA 3

There are no transcripts associated with this gene.

View Full Product Details